WormBase Tree Display for Feature: WBsf919627
expand all nodes | collapse all nodes | view schema
| WBsf919627 | SMap | S_parent | Sequence | C42D8 |
|---|---|---|---|---|
| Name | Public_name | 247-bp promoter of vit-2 (pJ247). See Figure 2A of WBPaper00001523 | ||
| Sequence_details | Flanking_sequences | atcgttaaaaagtcatgagtatcaaagtgcagtgt | aggtcgatcatcatcgcctctctcgtggccttggccctcgcc | |
| Mapping_target | C42D8 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is the 247-base promoter region for the gene vit-2 | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00001523 | ||
| WBPaper00001864 | ||||
| Associations | Associated_with_gene | WBGene00006926 | ||
| Associated_with_expression_pattern | Expr11396 | |||
| Associated_with_construct | WBCnstr00018820 | |||
| Remark | This is the 247-base promoter region (pJ247) for the gene vit-2 which drives expression in intestines in adult hermaphrodites [2013-07-23 gw3] | |||
| Method | promoter |
