WormBase Tree Display for Feature: WBsf919627
expand all nodes | collapse all nodes | view schema
WBsf919627 | SMap | S_parent | Sequence | C42D8 |
---|---|---|---|---|
Name | Public_name | 247-bp promoter of vit-2 (pJ247). See Figure 2A of WBPaper00001523 | ||
Sequence_details | Flanking_sequences | atcgttaaaaagtcatgagtatcaaagtgcagtgt | aggtcgatcatcatcgcctctctcgtggccttggccctcgcc | |
Mapping_target | C42D8 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the 247-base promoter region for the gene vit-2 | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00001523 | ||
WBPaper00001864 | ||||
Associations | Associated_with_gene | WBGene00006926 | ||
Associated_with_expression_pattern | Expr11396 | |||
Associated_with_construct | WBCnstr00018820 | |||
Remark | This is the 247-base promoter region (pJ247) for the gene vit-2 which drives expression in intestines in adult hermaphrodites [2013-07-23 gw3] | |||
Method | promoter |