WormBase Tree Display for Expr_pattern: Expr5983
expand all nodes | collapse all nodes | view schema
Expr5983 | Expression_of | Gene | WBGene00004483 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004483 | ||
Homol | Homol_homol | F37C12:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [rps-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGGAAAATTAAAAAGTGTAGA] 3' and primer B 5' [TACGAGCGGGAGCGATTA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; hypodermis; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; hypodermis; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11062 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002468 |