WormBase Tree Display for Expr_pattern: Expr5983
expand all nodes | collapse all nodes | view schema
Expr5983 | Expression_of | Gene | WBGene00004483 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004483 | ||||
Homol | Homol_homol | F37C12:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [rps-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGGAAAATTAAAAAGTGTAGA] 3' and primer B 5' [TACGAGCGGGAGCGATTA] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; hypodermis; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; hypodermis; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC11062 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002468 |