WormBase Tree Display for Expr_pattern: Expr5403
expand all nodes | collapse all nodes | view schema
Expr5403 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C32F10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (13) | |||
Type | Reporter_gene | [C32F10.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACCGTATGAAGTTTAAAGGCACA] 3' and primer B 5' [GTACGGTTCGGATGCTGTAAA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; Nervous System; head neurons; | |||
Picture | WBPicture0000004070 | ||
WBPicture0000004071 | |||
WBPicture0000004072 | |||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||
Strain: BC11111 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002495 |