WormBase Tree Display for Expr_pattern: Expr5403
expand all nodes | collapse all nodes | view schema
Expr5403 | Expression_of | Gene | WBGene00016333 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00016333 | ||
Homol | Homol_homol | C32F10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0003822 | |||
WBbt:0003833 | |||
WBbt:0005319 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0005828 | |||
WBbt:0006749 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [C32F10.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACCGTATGAAGTTTAAAGGCACA] 3' and primer B 5' [GTACGGTTCGGATGCTGTAAA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; Nervous System; head neurons; | |||
Picture | WBPicture0000004070 | ||
WBPicture0000004071 | |||
WBPicture0000004072 | |||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||
Strain: BC11111 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002495 |