WormBase Tree Display for Variation: WBVar02156986
expand all nodes | collapse all nodes | view schema
WBVar02156986 | Evidence | Person_evidence | WBPerson52545 | ||
---|---|---|---|---|---|
Name | Public_name | xd310 | |||
Other_name | CE29663:p.Gly210Glu | ||||
CE30480:p.Gly210Glu | |||||
C05D11.7a.1:c.629G>A | |||||
C05D11.7b.1:c.629G>A | |||||
HGVSg | CHROMOSOME_III:g.6418332C>T | ||||
Sequence_details | SMap | S_parent | Sequence | C05D11 | |
Flanking_sequences | atatttctagttgtaaatctaattgaagtt | cgttgaagtccactccaagcatgcttccac | |||
Mapping_target | C05D11 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Origin | Species | Caenorhabditis elegans | |||
Status | Live | ||||
Affects | Gene | WBGene00015484 | |||
Transcript (2) | |||||
Isolation | Mutagen | EMS | |||
Genetics | Interpolated_map_position | III | -1.28275 | ||
Disease_info | Models_disease | DOID:0050729 | |||
Models_disease_in_annotation | WBDOannot00001199 | ||||
Remark | Batch Variation object requested via get_NS_ids.pl | ||||
alt_det = G210E | Person_evidence | WBPerson52545 | |||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson52545 on 2021-10-31_07:41:16 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |