WormBase Tree Display for Variation: WBVar02156986
expand all nodes | collapse all nodes | view schema
| WBVar02156986 | Evidence | Person_evidence | WBPerson52545 | ||
|---|---|---|---|---|---|
| Name | Public_name | xd310 | |||
| Other_name | CE29663:p.Gly210Glu | ||||
| CE30480:p.Gly210Glu | |||||
| C05D11.7a.1:c.629G>A | |||||
| C05D11.7b.1:c.629G>A | |||||
| HGVSg | CHROMOSOME_III:g.6418332C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | C05D11 | |
| Flanking_sequences | atatttctagttgtaaatctaattgaagtt | cgttgaagtccactccaagcatgcttccac | |||
| Mapping_target | C05D11 | ||||
| Type_of_mutation | Substitution | c | t | ||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Status | Live | ||||
| Affects | Gene | WBGene00015484 | |||
| Transcript | C05D11.7a.1 (12) | ||||
| C05D11.7b.1 (12) | |||||
| Isolation | Mutagen | EMS | |||
| Genetics | Interpolated_map_position | III | -1.28275 | ||
| Disease_info | Models_disease | DOID:0050729 | |||
| Models_disease_in_annotation | WBDOannot00001199 | ||||
| Remark | Batch Variation object requested via get_NS_ids.pl | ||||
| alt_det = G210E | Person_evidence | WBPerson52545 | |||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson52545 on 2021-10-31_07:41:16 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
| Method | Substitution_allele |
