WormBase Tree Display for Variation: WBVar02156985
expand all nodes | collapse all nodes | view schema
WBVar02156985 | Evidence | Person_evidence | WBPerson52545 | ||
---|---|---|---|---|---|
Name | Public_name | xd314 | |||
Other_name | CE30480:p.Gly19Arg | ||||
CE29663:p.Gly19Arg | |||||
C05D11.7a.1:c.55G>A | |||||
C05D11.7b.1:c.55G>A | |||||
HGVSg | CHROMOSOME_III:g.6419400C>T | ||||
Sequence_details | SMap | S_parent | Sequence | C05D11 | |
Flanking_sequences | cgactccagcgtggtaaacacaaaggaatc | acaacccgagaaggacaaattcataagctc | |||
Mapping_target | C05D11 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00059115 | ||||
WBStrain00059116 | |||||
WBStrain00059117 | |||||
WBStrain00059120 | |||||
WBStrain00059124 | |||||
Laboratory | XD | ||||
Status | Live | ||||
Affects | Gene | WBGene00015484 | |||
Transcript | C05D11.7a.1 (12) | ||||
C05D11.7b.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Genetics | Interpolated_map_position | III | -1.2826 | ||
Disease_info | Models_disease | DOID:0050729 | |||
Models_disease_in_annotation | WBDOannot00001200 | ||||
Reference | WBPaper00066161 | ||||
Remark | Batch Variation object requested via get_NS_ids.pl | ||||
alt_det = G19R | Person_evidence | WBPerson52545 | |||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson52545 on 2021-10-31_07:33:23 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |