WormBase Tree Display for Variation: WBVar02146622
expand all nodes | collapse all nodes | view schema
WBVar02146622 | Evidence | Paper_evidence | WBPaper00050051 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ox352 | |||||
Other_name (32) | |||||||
HGVSg | CHROMOSOME_IV:g.6166892A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C11D2 | |||
Flanking_sequences | ttttttgagctcttcgtccatttccaagtt | tcaagaattacggcaacgaacagggagagc | |||||
Mapping_target | C11D2 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | EG | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006809 | |||||
Transcript (16) | |||||||
Genetics | Interpolated_map_position | IV | 3.06174 | ||||
Reference | WBPaper00050051 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |