WormBase Tree Display for Variation: WBVar02123428
expand all nodes | collapse all nodes | view schema
WBVar02123428 | Name | Public_name | WBVar02123428 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854351 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y41G9A | ||||
Flanking_sequences | AATAGTTCAGAAAAATACTTTGAAAGTAAG | TGTGCGAAAACTAATCGCTAAAAAGTTTTA | ||||||
Mapping_target | Y41G9A | |||||||
Source_location | 225 | CHROMOSOME_X | 2979399 | 2998836 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin (5) | ||||||||
Affects | Gene | WBGene00304825 | ||||||
WBGene00021526 | ||||||||
WBGene00003885 | ||||||||
WBGene00166186 | ||||||||
WBGene00220158 | ||||||||
WBGene00021527 | ||||||||
Transcript | Y41G9A.1.1 | |||||||
Y41G9A.12 | ||||||||
Y41G9A.16 | ||||||||
Y41G9A.17.1 | ||||||||
Y41G9A.3.1 | ||||||||
Y41G9A.2.1 | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |