WormBase Tree Display for Variation: WBVar01500123
expand all nodes | collapse all nodes | view schema
WBVar01500123 | Name | Public_name | gk964339 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | AAATTCTGAAAAAAGTTTACAGAAGAAGAT | AAACGGTCTGAAACAGGCGCAGAGGAGACT | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 5385420 | 6208211 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Insertion | ATAAAA | ||||||
Tandem_duplication | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00039799 | |||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (258) | |||||||
Transcript (460) | ||||||||
Pseudogene | F40H6.2 | |||||||
F40H6.6 | ||||||||
Y37B11A.8 | ||||||||
Reference | WBPaper00042537 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | Million_mutation |