WormBase Tree Display for Variation: WBVar01499061

WBVar01499061 Name: Public_name: gk962865
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_III
    Flanking_sequences: TGTTTGTTCTGAACGCTCTCAAACATCGTC TGATGATTGCATAACCTGTCTCTCTGATGT
    Mapping_target: CHROMOSOME_III
    Source_location: 225 CHROMOSOME_III 8166001 8274000 From_analysis: Million_mutation_project_reanalysis
    Type_of_mutation: Tandem_duplication
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00038476
    Laboratory: VC
    Analysis: Million_mutation_project_reanalysis
    Status: Live
  Affects: Gene (48)
    Transcript (54)
    Pseudogene: C30A5.4
  Reference: WBPaper00042537
  Remark: The boundaries of this variant have been identified only approximately
    This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous
  Method: Million_mutation