WormBase Tree Display for Variation: WBVar01498854
expand all nodes | collapse all nodes | view schema
WBVar01498854 | Name | Public_name | gk962556 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
Flanking_sequences | AAACTTGCACCTAGGCCACATCAGCATGCC | TTTTTACATACGCCAAATTTAACGCTGCAA | ||||||
Mapping_target | CHROMOSOME_X | |||||||
Source_location | 225 | CHROMOSOME_X | 3555001 | 3575000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00038052 | |||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006928 | ||||||
WBGene00020845 | ||||||||
WBGene00197773 | ||||||||
WBGene00006927 | ||||||||
WBGene00196684 | ||||||||
WBGene00004350 | ||||||||
Transcript (14) | ||||||||
Reference | WBPaper00042537 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | Million_mutation |