WormBase Tree Display for Variation: WBVar01474055
expand all nodes | collapse all nodes | view schema
WBVar01474055 | Name | Public_name | tm6222 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C33F10.8.1:c.267_456del | |||||||
CE29695:p.Lys90ProfsTer8 | ||||||||
HGVSg | CHROMOSOME_II:g.4824410_4824790del | |||||||
Sequence_details | SMap | S_parent | Sequence | C33F10 | ||||
Flanking_sequences | aatattcatgaggtggttcgagaagaaggt | ttcctaccaaatccagctggagatttgtca | ||||||
Mapping_target | C33F10 | |||||||
Source_location | 7 | CHROMOSOME_II | 4824409 | 4824791 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6222_external | |||||||
tm6222_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6222 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016356 | ||||||
Transcript | C33F10.8.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Remark | 29217/29218-29598/29599 (381 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |