WormBase Tree Display for Variation: WBVar00323242
expand all nodes | collapse all nodes | view schema
WBVar00323242 | Evidence | Paper_evidence | WBPaper00038066 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | kr193 | ||||||
Other_name | R07G3.9.1:c.168+5G>A | |||||||
HGVSg | CHROMOSOME_II:g.7613795G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R07G3 | ||||
Flanking_sequences | TTCAAACGGTTTTGTCAGATAATAGAGCGA | TTTCAGAAATAAAAAAAATGATACAAAATT | ||||||
Mapping_target | R07G3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00038066 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | EN | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00043050 | ||||||
Transcript | R07G3.9.1 | VEP_consequence | splice_region_variant,intron_variant | |||||
VEP_impact | LOW | |||||||
HGVSc | R07G3.9.1:c.168+5G>A | |||||||
Intron_number | 2/5 | |||||||
Interactor | WBInteraction000501252 | |||||||
Genetics | Interpolated_map_position | II | 0.506578 | |||||
Description | Phenotype | WBPhenotype:0000112 | Paper_evidence | WBPaper00038066 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | LEV-9 protein was barely detectable by immunoprecipitation(IP) in oig-4 mutant extracts. However, LEV-10 was expressed at levels similar to the wild type based on western blot analysis of fractionated worm extracts. Also western blot analysis of L-AChR subunit UNC-29 expression indicated that the L-AChR expression level was similar to wild type. | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00038066 | ||||||
Person_evidence | WBPerson6376 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The levamisole sensitivity of these mutants is intermediate between the wild-type and the lev-9 and lev-10 mutants when assaying paralysis after both short and prolonged exposure to levamisole. The decreased sensitivity to levamisole was rescued by providing a 2.3-kb genomic fragment encompassing the oig-4 coding region surrounded by 1.1 kb upstream and 0.4 kb downstream to the ORF. | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00038066 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The size of the L-AChR-dependent evoked responses of oig-4 mutants was similar to the wild type. In unc-49; acr-16; oig-4 triple mutants, the time-to-peak and decay time of the evoked currents were significantly increased when compared with unc-49; acr-16. | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | This analysis was performed in an acr-16; unc-49 double mutant background to eliminate currents due to the activation of N-AChRs and GABA receptors. | Paper_evidence | WBPaper00038066 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001852 | Person_evidence | WBPerson6376 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson6376 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00038066 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Other than altered levamisole sensitivity, no additional phenotype could be identified.. | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00038066 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Other than altered levamisole sensitivity, no additional phenotype could be identified.. | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson6376 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001015 | Person_evidence | WBPerson6376 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002165 | Paper_evidence | WBPaper00038066 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pressure-ejection of levamisole on voltage-clamped muscle cells elicited currents similar in oig-4 null mutants and wild-type animals. | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038066 | |||||||
Method | Substitution_allele |