WormBase Tree Display for Variation: WBVar00278273
expand all nodes | collapse all nodes | view schema
WBVar00278273 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk965 | |||
Other_name (18) | |||||
HGVSg | CHROMOSOME_IV:g.11982107G>A | ||||
Sequence_details | SMap | S_parent | Sequence | ZK617 | |
Flanking_sequences | TTCTGGTAGATGGAATAACCAACTTGGTCT | AGAATCAGTTGTTTCAACTCCAGCCAATGG | |||
Mapping_target | ZK617 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006759 | |||
Transcript | ZK617.1i.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1i.1:c.13414C>T | ||||
HGVSp | CE49956:p.Gln4472Ter | ||||
cDNA_position | 13414 | ||||
CDS_position | 13414 | ||||
Protein_position | 4472 | ||||
Exon_number | 29/33 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1a.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1a.1:c.12532C>T | ||||
HGVSp | CE33017:p.Gln4178Ter | ||||
cDNA_position | 12659 | ||||
CDS_position | 12532 | ||||
Protein_position | 4178 | ||||
Exon_number | 28/33 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1g.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1g.1:c.12559C>T | ||||
HGVSp | CE46868:p.Gln4187Ter | ||||
cDNA_position | 12559 | ||||
CDS_position | 12559 | ||||
Protein_position | 4187 | ||||
Exon_number | 28/32 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1f.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1f.1:c.12796C>T | ||||
HGVSp | CE46948:p.Gln4266Ter | ||||
cDNA_position | 12796 | ||||
CDS_position | 12796 | ||||
Protein_position | 4266 | ||||
Exon_number | 27/31 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1d.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1d.1:c.11371C>T | ||||
HGVSp | CE49926:p.Gln3791Ter | ||||
cDNA_position | 11371 | ||||
CDS_position | 11371 | ||||
Protein_position | 3791 | ||||
Exon_number | 18/22 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1c.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1c.1:c.11872C>T | ||||
HGVSp | CE47057:p.Gln3958Ter | ||||
cDNA_position | 12133 | ||||
CDS_position | 11872 | ||||
Protein_position | 3958 | ||||
Exon_number | 22/26 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1h.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1h.1:c.13441C>T | ||||
HGVSp | CE49973:p.Gln4481Ter | ||||
cDNA_position | 13441 | ||||
CDS_position | 13441 | ||||
Protein_position | 4481 | ||||
Exon_number | 30/34 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1b.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1b.1:c.13489C>T | ||||
HGVSp | CE33018:p.Gln4497Ter | ||||
cDNA_position | 13489 | ||||
CDS_position | 13489 | ||||
Protein_position | 4497 | ||||
Exon_number | 30/34 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
ZK617.1e.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | ZK617.1e.1:c.11320C>T | ||||
HGVSp | CE44668:p.Gln3774Ter | ||||
cDNA_position | 11320 | ||||
CDS_position | 11320 | ||||
Protein_position | 3774 | ||||
Exon_number | 17/21 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Allele confirmed by Sanger sequencing | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |