WormBase Tree Display for Variation: WBVar00277183

WBVar00277183 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2476
    Other_name (23)
    HGVSg: CHROMOSOME_X:g.10777895A>T
  Sequence_details: SMap: S_parent: Sequence: T05A10
    Flanking_sequences: TCAACAACCAATGTTTGCAGTACAAGATGG ACTTTATCGATGTATGCGAAATGGAACGTT
    Mapping_target: T05A10
    Type_of_mutation: Substitution: A T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037339
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004862
    Transcript (14)
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele