WormBase Tree Display for Variation: WBVar00266629
expand all nodes | collapse all nodes | view schema
WBVar00266629 | Evidence | Paper_evidence | WBPaper00035070 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | u267 | |||||||
Other_name | CE02308:p.Gly191Glu | ||||||||
T01E8.4.1:c.572G>A | |||||||||
HGVSg | CHROMOSOME_II:g.10239069C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01E8 | |||||
Flanking_sequences | ctgtaaaaagttggcacatcacagataatg | agctcttcaaaatcttaattccgtgaatgtt | |||||||
Mapping_target | T01E8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035070 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | TU | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | II | 2.31428 | ||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00035070 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | This mutation confers partial touch insensitivity. some animals respond to many touches while others fail to respond after a few touches. The severity of the phenotype increases at higher temperatures. | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00035070 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited distorted cell-body morphology; somas were generally larger and misshapen as well as accumulated more jsIs821[RAB-3::GFP] reporter product. This phenotype is stronger at higher temperatures. | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Paper_evidence | WBPaper00035070 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001933 | Paper_evidence | WBPaper00035070 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The pattern of jsIs821[RAB-3::GFP] localization was disrupted; often reduced or abolished. This phenotype is stronger at higher temperatures. Localization of non-synaptic components appear to be normal. The distribution of a non-synaptic component, mechanosensory channel subunit, appears to be normal. Levels of MEC-18, that is diffusely expressed in the cytoplasm were unchanged in these mutants compared to control animals. The density of TRN microtubules were also unaffected compared to control animals. | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00035070 | ||||||||
Remark | u267 contains two missense mutations:F21L and G191E; the flanking sequences for G191E are entered above. The F21L sequence change is c to a (ttc to taa). | Person_evidence | WBPerson95 | ||||||
Method | Substitution_allele |