WormBase Tree Display for Variation: WBVar00266516

WBVar00266516 Evidence: Paper_evidence: WBPaper00035070
  Name: Public_name: u53
    Other_name: CE02308:p.Gly159Glu
      T01E8.4.1:c.476G>A
    HGVSg: CHROMOSOME_II:g.10239165C>T
  Sequence_details: SMap: S_parent: Sequence: T01E8
    Flanking_sequences: cagtggcaaaagatgatacagctcattctg atggatttggaatatggctcaagagagcaca
    Mapping_target: T01E8
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00035070
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: TU
    Status: Live
  Affects: Gene: WBGene00003177
    Transcript: T01E8.4.1 (12)
  Genetics: Interpolated_map_position: II 2.31469
  Description: Phenotype: WBPhenotype:0000315 Paper_evidence: WBPaper00035070
        Curator_confirmed: WBPerson712
        Remark: This mutation confers partial touch insensitivity. some animals respond to many touches while others fail to respond after a few touches. The severity of the phenotype increases at higher temperatures. Paper_evidence: WBPaper00035070
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00035070
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035070
              Curator_confirmed: WBPerson712
      WBPhenotype:0000905 Paper_evidence: WBPaper00035070
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited distorted cell-body morphology; somas were generally larger and misshapen as well as accumulated more jsIs821[RAB-3::GFP] reporter product. This phenotype is stronger at higher temperatures. Paper_evidence: WBPaper00035070
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00035070
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005237 PATO:0000460 Paper_evidence: WBPaper00035070
                Curator_confirmed: WBPerson712
      WBPhenotype:0001933 Paper_evidence: WBPaper00035070
        Curator_confirmed: WBPerson712
        Remark: The pattern of jsIs821[RAB-3::GFP] localization was disrupted; often reduced or abolished. This phenotype is stronger at higher temperatures. Localization of non-synaptic components appear to be normal. The distribution of a non-synaptic component, mechanosensory channel subunit, appears to be normal. Levels of MEC-18, that is diffusely expressed in the cytoplasm were unchanged in these mutants compared to control animals. The density of TRN microtubules were also unaffected compared to control animals. Paper_evidence: WBPaper00035070
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00035070
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00035070
              Curator_confirmed: WBPerson712
  Reference: WBPaper00035070
  Method: Substitution_allele