WormBase Tree Display for Variation: WBVar00253092
expand all nodes | collapse all nodes | view schema
WBVar00253092 | Evidence | Paper_evidence | WBPaper00031871 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | tr78 | ||||||
Other_name | CE28820:p.Val1159Leu | |||||||
C48A7.1a.1:c.3475G>C | ||||||||
C48A7.1b.1:c.3475G>C | ||||||||
CE31165:p.Val1159Leu | ||||||||
HGVSg | CHROMOSOME_IV:g.7412341G>C | |||||||
Sequence_details | SMap | S_parent | Sequence | C48A7 | ||||
Flanking_sequences | ttggatgtgttcaatttgattttcactgga | ttttcgcatttgaagctgttctgaagattg | ||||||
Mapping_target | C48A7 | |||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00031871 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | RP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001187 | ||||||
Transcript | C48A7.1a.1 (12) | |||||||
C48A7.1b.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 3.33453 | |||||
Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were resistant to population growth retardation induced by nemadipine-A, a dihydropyridine (DHP) analog. | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were treated with various concentrations of nemadipine in DMSO. | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031871 | |||||||
Method | Substitution_allele |