WormBase Tree Display for Variation: WBVar00253089
expand all nodes | collapse all nodes | view schema
WBVar00253089 | Evidence | Paper_evidence | WBPaper00031871 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | tr75 | ||||||
Other_name | CE28820:p.Ser1010Leu | |||||||
CE31165:p.Ser1010Leu | ||||||||
C48A7.1b.1:c.3028_3029delinsCT | ||||||||
C48A7.1a.1:c.3028_3029delinsCT | ||||||||
HGVSg | CHROMOSOME_IV:g.7411894_7411895delinsCT | |||||||
Sequence_details | SMap | S_parent | Sequence | C48A7 | ||||
Flanking_sequences | ggagatgcgatgatttcacttttcgtagtt | aactttcgaaggatggccacaacttcttta | ||||||
Mapping_target | C48A7 | |||||||
Type_of_mutation | Substitution | tc | ct | Paper_evidence | WBPaper00031871 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | RP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001187 | ||||||
Transcript | C48A7.1a.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | C48A7.1a.1:c.3028_3029delinsCT | |||||||
HGVSp | CE28820:p.Ser1010Leu | |||||||
cDNA_position | 3028-3029 | |||||||
CDS_position | 3028-3029 | |||||||
Protein_position | 1010 | |||||||
Exon_number | 9/17 | |||||||
Codon_change | TCa/CTa | |||||||
Amino_acid_change | S/L | |||||||
C48A7.1b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | C48A7.1b.1:c.3028_3029delinsCT | |||||||
HGVSp | CE31165:p.Ser1010Leu | |||||||
cDNA_position | 3028-3029 | |||||||
CDS_position | 3028-3029 | |||||||
Protein_position | 1010 | |||||||
Exon_number | 9/18 | |||||||
Codon_change | TCa/CTa | |||||||
Amino_acid_change | S/L | |||||||
Genetics | Interpolated_map_position | IV | 3.33451 | |||||
Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were resistant to population growth retardation induced by nemadipine-A, a dihydropyridine (DHP) analog. | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were treated with various concentrations of nemadipine in DMSO. | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031871 | |||||||
Method | Substitution_allele |