WormBase Tree Display for Variation: WBVar00250892
expand all nodes | collapse all nodes | view schema
WBVar00250892 | Name | Public_name | tm1931 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_V:g.3984468_3984961delinsAAAA | |||||||
Sequence_details | SMap | S_parent | Sequence | B0213 | ||||
Flanking_sequences | aaaacaaaaatgatttcaacctcttcaatt | aaaattacagtagaggagcttattttgaaa | ||||||
Mapping_target | B0213 | |||||||
Source_location | 7 | CHROMOSOME_V | 3984467 | 3984962 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AAAA | ||||||
Deletion | ||||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1931 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003767 | ||||||
Transcript | B0213.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | 44-? | |||||||
CDS_position | 22-? | |||||||
Protein_position | 8-? | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 2-4/4 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No marked difference in lifespan, in the absence of infection, was observed compared to wild type. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000072 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal morphology. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000145 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000639 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: does not form dauer at 25C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No marked change in resistance to D. coniospora infection was observed compared to wild type. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032031 | |||||||
Remark | 32394/32395-AAAA-32888/32889 (494 bp deletion + 4 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |