WormBase Tree Display for Variation: WBVar00250708
expand all nodes | collapse all nodes | view schema
WBVar00250708 | Name | Public_name | tm1743 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE05945:p.Ile65_Asp207delinsGlnSerPheLeuTyrIleSerCysSerAsnCysSerSer | ||||||||
F55A11.3.1:c.193_620delinsCAAAGTTTCTTGTATATCTCATGTTCCAATTGCTCAAG | |||||||||
HGVSg | CHROMOSOME_V:g.11767536_11768008delinsCAAAGTTTCTTGTATATCTCATGTTCCAATTGCTCAAG | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55A11 | |||||
Flanking_sequences | gtatatctcatgttccaattgctcaagtct | taacaaagccgtttacctgctctacgcaga | |||||||
Mapping_target | F55A11 | ||||||||
Source_location | 7 | CHROMOSOME_V | 11767535 | 11768009 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | CAAAGTTTCTTGTATATCTCATGTTCCAATTGCTCAAG | |||||||
Deletion | |||||||||
PCR_product | tm1743_external | ||||||||
tm1743_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | |||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1743 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004768 | |||||||
Transcript | F55A11.3.1 (11) | ||||||||
Interactor | WBInteraction000520511 | ||||||||
WBInteraction000536213 | |||||||||
WBInteraction000536214 | |||||||||
WBInteraction000536215 | |||||||||
WBInteraction000536216 | |||||||||
WBInteraction000536217 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00030999 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | hrd-1(tm1743) deletion mutant showed a slightly slow growth rate (Fig. 3A). | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000122 | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
Remark | postranslational processing of SKN-1A[ΔDBD]::GFP abnormal; Figure 3 | Paper_evidence | WBPaper00049977 | ||||||
Curator_confirmed | WBPerson5649 | ||||||||
postranslational processing of HA::SKN-1A::GFP abnormal; Figure 6 | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
Phenotype_assay | Control_strain | WBStrain00043200 | Paper_evidence | WBPaper00049977 | |||||
Curator_confirmed | WBPerson5649 | ||||||||
WBStrain00043201 | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
Genotype | mgTi2[rpl-28::skn-1a[ΔDBD]::gfp] | Paper_evidence | WBPaper00049977 | ||||||
Curator_confirmed | WBPerson5649 | ||||||||
mgTi4[rpl-28::HA::skn-1a::gfp] | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00030999 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As expected from results shown in Fig. 4A, expression of endogenous hsp-3 and hsp-4 genes was increased by the HRD-1 deletion (Supplementary Fig. S3)." | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
Remark | localization of SKN-1A::GFP abnormal; Figure 3 | Paper_evidence | WBPaper00049977 | ||||||
Curator_confirmed | WBPerson5649 | ||||||||
Phenotype_assay | Control_strain | WBStrain00007962 | Paper_evidence | WBPaper00049977 | |||||
Curator_confirmed | WBPerson5649 | ||||||||
Genotype | mgTi1[rpl-28::skn-1a::gfp | Paper_evidence | WBPaper00049977 | ||||||
Curator_confirmed | WBPerson5649 | ||||||||
WBPhenotype:0001236 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. A. Colavita to the National Bioresource Project of Japan: up-regulation of hsp-4::gfp. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OU | ||||||||
WBPhenotype:0001918 | Paper_evidence | WBPaper00030999 | |||||||
WBPaper00049977 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPerson5649 | |||||||||
Remark | "DTT, which is a reducing reagent that affects the protein folding environment in the ER as well as the cytosol, greatly reduced growth rate of hrd-1(tm1743) mutant and marc-6(RNAi) worms." | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Thapsigargin, which is an ER membrane Ca2+-ATPase inhibitor, depletes calcium stores and affects the protein folding environment in the ER, slightly affected growth rate of hrd-1(tm1743) mutant." | Paper_evidence | WBPaper00030999 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
increased sensitivity to bortezomib; Figure 1, bortezomib concentration required to cause developmental arrest is ~10x lower than wild type | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00049977 | ||||||
Curator_confirmed | WBPerson5649 | ||||||||
Affected_by | Molecule | WBMol:00004908 | Paper_evidence | WBPaper00030999 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002963 | Paper_evidence | WBPaper00030999 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00003099 | Paper_evidence | WBPaper00049977 | |||||||
Curator_confirmed | WBPerson5649 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049977 | |||||
Curator_confirmed | WBPerson5649 | ||||||||
Treatment | Eggs were laid on plates containing 5 millimolar DTT for 2 hours and analyzed after 72 hours | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Eggs were laid on plates containing 5 micromolar thapsigargin for 2 hours and analyzed after 72 hours | Paper_evidence | WBPaper00030999 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002602 | Paper_evidence | WBPaper00060631 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals harboring mutations in marc-6 and hrd-1 also reverse significantly less than wild-type animals (Figure 1A). | Paper_evidence | WBPaper00060631 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Sawa to the National Bioresource Project of Japan: healthy. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | HS | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comments to the National Bioresource Project of Japan: Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000633 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. A. Colavita to the National Bioresource Project of Japan: no VC axon branching defects. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OU | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. T. Schedl to the National Bioresource Project of Japan: no germline phenotypes. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | BS | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00061619 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00061619 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Sawa to the National Bioresource Project of Japan: no obvious Psa phenotype. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | HS | ||||||||
WBPhenotype:0001507 | Paper_evidence | WBPaper00061619 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002057 | Paper_evidence | WBPaper00061619 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Reference | WBPaper00030999 | ||||||||
WBPaper00049977 | |||||||||
WBPaper00060631 | |||||||||
WBPaper00061619 | |||||||||
WBPaper00065342 | |||||||||
Remark | 4110/4111-CAAAGTTTCTTGTATATCTCATGTTCCAATTGCTCAAG-4583/4584 (473 bp deletion + 38 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |