WormBase Tree Display for Variation: WBVar00249258
expand all nodes | collapse all nodes | view schema
WBVar00249258 | Evidence | Paper_evidence | WBPaper00005198 | ||
---|---|---|---|---|---|
Name | Public_name | te51 | |||
Other_name | ZC513.6.1:c.417-1G>A | ||||
HGVSg | CHROMOSOME_V:g.8030064G>A | ||||
Sequence_details | SMap | S_parent | Sequence | ZC513 | |
Flanking_sequences | ttgaattaagattacacaacatattttaca | gatcgaggcacgtcaaaacaataagtaccg | |||
Mapping_target | ZC513 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (18) | |||||
Laboratory | TX | ||||
Status | Live | ||||
Affects | Gene | WBGene00003865 | |||
Transcript | ZC513.6.1 | VEP_consequence | splice_acceptor_variant | ||
VEP_impact | HIGH | ||||
HGVSc | ZC513.6.1:c.417-1G>A | ||||
Intron_number | 4/7 | ||||
Interactor | WBInteraction000504500 | ||||
WBInteraction000504501 | |||||
WBInteraction000504502 | |||||
WBInteraction000524490 | |||||
WBInteraction000524794 | |||||
Genetics | Interpolated_map_position | V | 1.0043 | ||
Reference | WBPaper00010802 | ||||
WBPaper00012537 | |||||
WBPaper00018768 | |||||
Remark | a G to A change, this affects the -1 position of the 3' splice site of intron 3 [021016 ck1] | ||||
Method | Substitution_allele |