WormBase Tree Display for Variation: WBVar00241149
expand all nodes | collapse all nodes | view schema
WBVar00241149 | Evidence | Paper_evidence | WBPaper00004450 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q519 | |||||||
Other_name | K04D7.5b.1:c.684T>A | ||||||||
K04D7.5a.1:c.684T>A | |||||||||
CE40976:p.Tyr228Ter | |||||||||
CE35579:p.Tyr228Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.10198638T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K04D7 | |||||
Flanking_sequences | atcagaagacgttcagaacgaagaggatta | gttttaaatatgactctgaatgatacacgt | |||||||
Mapping_target | K04D7 | ||||||||
Type_of_mutation | Substitution | t | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022572 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001653 | |||||||
Transcript | K04D7.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K04D7.5a.1:c.684T>A | ||||||||
HGVSp | CE35579:p.Tyr228Ter | ||||||||
cDNA_position | 687 | ||||||||
CDS_position | 684 | ||||||||
Protein_position | 228 | ||||||||
Exon_number | 5/16 | ||||||||
Codon_change | taT/taA | ||||||||
Amino_acid_change | Y/* | ||||||||
K04D7.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K04D7.5b.1:c.684T>A | ||||||||
HGVSp | CE40976:p.Tyr228Ter | ||||||||
cDNA_position | 684 | ||||||||
CDS_position | 684 | ||||||||
Protein_position | 228 | ||||||||
Exon_number | 4/15 | ||||||||
Codon_change | taT/taA | ||||||||
Amino_acid_change | Y/* | ||||||||
Interactor | WBInteraction000538729 | ||||||||
WBInteraction000556203 | |||||||||
WBInteraction000556204 | |||||||||
Genetics | Interpolated_map_position | IV | 4.55949 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00026839 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We also examined fkh-6::GFP expression in gon-4(RNAi) animals and gon-4(q519) mutants and found no defects (n = 26, Figure 6G)." | Paper_evidence | WBPaper00026839 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007854 | PATO:0000460 | Paper_evidence | WBPaper00026839 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | ezIs2 [fkh-6::GFP] | Paper_evidence | WBPaper00026839 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001968 | Paper_evidence | WBPaper00026839 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "GFP::POP-1 localization was also not affected by gon-4(RNAi) (Figures 5K-5M)." (text and figure legend say gon-4(RNAi) but figure indicates it is the gon-4(q519) allele) | Paper_evidence | WBPaper00026839 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007854 | PATO:0000460 | Paper_evidence | WBPaper00026839 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00026839 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00026839 | ||||||||
WBPaper00004450 | |||||||||
Method | Substitution_allele |