WormBase Tree Display for Variation: WBVar00239370
expand all nodes | collapse all nodes | view schema
WBVar00239370 | Evidence | Person_evidence | WBPerson692 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | pk1426 | |||||||
Other_name | F10B5.7.1:c.1028+16_3735del | ||||||||
HGVSg | CHROMOSOME_II:g.8163749_8166763del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F10B5 | |||||
Flanking_sequences | cacagtttgtagtgtgtaagttgcacatat | atgatgtcaggtggaaaaccgatgtactac | |||||||
Mapping_target | F10B5 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (23) | |||||||||
Laboratory | NL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004510 | |||||||
Transcript | F10B5.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F10B5.7.1:c.1028+16_3735del | ||||||||
cDNA_position | ?-3828 | ||||||||
CDS_position | ?-3735 | ||||||||
Protein_position | ?-1245 | ||||||||
Intron_number | 5-11/16 | ||||||||
Exon_number | 6-12/17 | ||||||||
Interactor (121) | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Interpolated_map_position | II | 0.737993 | ||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Control RNAi (bacteria not expressing any dsRNA). | Paper_evidence | WBPaper00032237 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00032237 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | DAF-16::GFP was localized in both the cytoplasm and nuclei of all tissues at all developmental stages, like that in wild-type control animals. | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | daf-16::GFP | Paper_evidence | WBPaper00032237 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035228 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PGL-1 staining in the germline resembles wild type and appear associated with nuclei periphery. | Paper_evidence | WBPaper00035228 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000693 | Paper_evidence | WBPaper00035246 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | rrf-3(pk1426) males produced sperm that were capable of fertilization | Paper_evidence | WBPaper00035246 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001256 | Paper_evidence | WBPaper00035246 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Similar patterns in N2 and rrf-3(pk1426) RAD-51 foci counts suggest successful DNA double strand breaks (DSBs) repair | Paper_evidence | WBPaper00035246 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These proteins are not required for piRNA expression, as determined by comparable levels of 21U-RNA on Northern blot and or qRT-PCR to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
21U-RNAs were expressed normally, as determined by Northern blot analysis. | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00027057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strains depleted of RRF-3 do not exhibit accumulation of the precursor miRNA species. | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002146 | Paper_evidence | WBPaper00027057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The accumulation of at least eight small RNAs corresponding to germline-expressed genes, including T01A4.3, did not appear to require this gene. | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00032237 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Presence and morphology of ciliated neurons were assayed by DiO. | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were maintained on control bacteria. | Paper_evidence | WBPaper00032237 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (36) | |||||||||
Remark | Original flanking sequences were obtained from Plasterk Lab, 11/05. Subsequent re-sequencing (6/09) gives the flanking sequences currently entered above, which are very similar to those quoted in WBPaper00004981. | ||||||||
Method | Deletion_allele |