WormBase Tree Display for Variation: WBVar00145614
expand all nodes | collapse all nodes | view schema
WBVar00145614 | Evidence | Paper_evidence | WBPaper00036056 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | gk207 | |||||
HGVSg | CHROMOSOME_III:g.10742413_10742711del | ||||||
Sequence_details | SMap | S_parent | Sequence | K01G5 | |||
Flanking_sequences | ggtttccgcactgtccggcttgaacgtgga | gcgcacttgcttgttttcaaaaagtttaaa | |||||
Mapping_target | K01G5 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | gk207_external | ||||||
gk207_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035711 | ||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006536 | |||||
Transcript | K01G5.7.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
cDNA_position | ?-20 | ||||||
CDS_position | ?-13 | ||||||
Protein_position | ?-5 | ||||||
Exon_number | 1-2/5 | ||||||
Isolation | Mutagen | TMP/UV | |||||
Genetics | Mapping_data | In_multi_point | 4722 | ||||
Description | Phenotype | WBPhenotype:0001224 | Paper_evidence | WBPaper00036056 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutants exhibited DD axon outgrowth defects | Paper_evidence | WBPaper00036056 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001672 | Paper_evidence | WBPaper00036056 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Commissure branches prematurely and fails to reach the dorsal nerve cord in a tbb-1(gk207) mutants | Paper_evidence | WBPaper00036056 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00036056 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The locomotion of tbb-1(gk207) single mutants was also similar to wild-type | Paper_evidence | WBPaper00036056 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00036056 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |