WormBase Tree Display for Variation: WBVar00145465
expand all nodes | collapse all nodes | view schema
WBVar00145465 | Name | Public_name | gk9 | ||||
---|---|---|---|---|---|---|---|
Other_name (16) | |||||||
HGVSg | CHROMOSOME_IV:g.6163313_6165599delinsGTGTAAAATGTTGGGAATACTCAATTTCCTGCGGAAACAGACGCTTTTTTTCAATTATTTTGGGGGAGTTTTCGGGAATTATAATTTGGGGGTTAGTCGGAAAAGGTCATCGAATCAAAGTACTCAAA | ||||||
Sequence_details | SMap | S_parent | Sequence | C11D2 | |||
Flanking_sequences | gaggtcattcttagtgattgaggaaaacac | taatgtttcaaaattgtcatcgacagtcaa | |||||
Mapping_target | C11D2 | ||||||
Type_of_mutation | Insertion | gtgtaaaatgttgggaatactcaatttcctgcggaaacagacgctttttttcaattattttgggggagttttcgggaattataatttgggggttagtcggaaaaggtcatcgaatcaaagtactcaaa | |||||
Deletion | |||||||
PCR_product | GK9_external | ||||||
GK9_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035028 | ||||||
WBStrain00035029 | |||||||
WBStrain00035482 | |||||||
WBStrain00040855 | |||||||
WBStrain00040862 | |||||||
WBStrain00040863 | |||||||
WBStrain00040864 | |||||||
WBStrain00040865 | |||||||
Component_of_genotype | WBGenotype00000089 | ||||||
WBGenotype00000090 | |||||||
Laboratory | VC | ||||||
Person | WBPerson427 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006809 | |||||
WBGene00171539 | |||||||
WBGene00049242 | |||||||
WBGene00165476 | |||||||
WBGene00047448 | |||||||
WBGene00046897 | |||||||
WBGene00174308 | |||||||
WBGene00047278 | |||||||
Transcript (23) | |||||||
Interactor | WBInteraction000501184 | ||||||
WBInteraction000503537 | |||||||
WBInteraction000586830 | |||||||
WBInteraction000586831 | |||||||
Genetics | Mapping_data | In_multi_point | 4509 | ||||
Description | Phenotype (18) | ||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The single mutant displays normal locomotion. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00043908 | ||||||
WBPaper00031592 | |||||||
WBPaper00025465 | |||||||
WBPaper00019702 | |||||||
WBPaper00048388 | |||||||
WBPaper00066271 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |