WormBase Tree Display for Variation: WBVar00145345
expand all nodes | collapse all nodes | view schema
WBVar00145345 | Evidence | Paper_evidence | WBPaper00031666 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | fr4 | ||||||
Other_name | K09A9.1.1:c.920T>A | |||||||
CE42581:p.Ile307Asn | ||||||||
HGVSg | CHROMOSOME_X:g.15609073T>A | |||||||
Sequence_details | SMap | S_parent | Sequence | K09A9 | ||||
Flanking_sequences | atgaaataactgaaaacgacgtgatgagta | ctaccaaaaggttgtggagattgttcgatt | ||||||
Mapping_target | K09A9 | |||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00031666 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00021978 | |||||||
WBStrain00021982 | ||||||||
Laboratory | IG | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00010700 | ||||||
Transcript | K09A9.1.1 (12) | |||||||
Interactor | WBInteraction000503573 | |||||||
WBInteraction000536530 | ||||||||
WBInteraction000536534 | ||||||||
Genetics | Interpolated_map_position | X | 22.9307 | |||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Life span is decreased compared to wild type animals. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Assayed on E. coli. | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit reduced expression of pnlp-29::GFP. Expression is rescued when nipi-3 is expressed in the epidermis and not the intestine. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | frIs7 | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000142 | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Upregulation of pnlp-29::GFP after infection with D. coniospora was abolished but animals still responded strongly to injury. In addition, nlp-29 and nlp-31 mRNA species were not induced upon infection but was similiarly induce compared to that in wild type animals upon wounding, as confirmed by qRT-PCR. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. Animals were wounded by microinjection needle pricking of the cuticle or by femtosecond laser busts. | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | frIs7 | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are 20-25% shorter than wild type worms as demonstrated by the mean time of flight (TOF) quantified with the Biosort Worm Sorter. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit a significant reduction in survival when infected with D. coniospora. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. | Paper_evidence | WBPaper00031666 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00041022 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | nipi-3(fr4) reduced, but did not block, the induction of Pnlp-29::GFP expression induced by Pcol-19::GPA-12* (* activated form of GPA-12) | Paper_evidence | WBPaper00041022 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP; Pcol-19::GPA-12* (* activated form of GPA-12) | Paper_evidence | WBPaper00041022 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001800 | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | nipi-3(fr4) is required for the response of C. elegans to infection | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0001838 | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Upon treatment with PMA, a robust upregulation of the nlp-29 reporter was seen in nipi-3(fr4) worms, similar to wild-type | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001839 | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were not resistant to PMA | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001840 | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Normal increase in pnlp-29::GFP expression after wounding | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00041022 | |||||||
WBPaper00033094 | ||||||||
WBPaper00031666 | ||||||||
WBPaper00066073 | ||||||||
Method | Substitution_allele |