WormBase Tree Display for Variation: WBVar00145087

WBVar00145087 Evidence: Paper_evidence: WBPaper00026789
  Name: Public_name: eb112
    Other_name: AC3.10.2:c.-10G>A
      AC3.10.1:c.-10G>A
    HGVSg: CHROMOSOME_V:g.10384338G>A
  Sequence_details: SMap: S_parent: Sequence: AC3
    Flanking_sequences: gtttatatgatttagacaagaaatttaaaa tgaaaaccaatgtcatggtattcaaagatt
    Mapping_target: AC3
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00026789
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: SL
    Status: Live
  Affects: Gene: WBGene00004964
    Transcript: AC3.10.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: AC3.10.1:c.-10G>A
        cDNA_position: 39
        Exon_number: 2/7
      AC3.10.2 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: AC3.10.2:c.-10G>A
        cDNA_position: 17
        Exon_number: 1/6
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00026789
  Genetics: Interpolated_map_position: V 2.53666
  Reference: WBPaper00026789
  Remark: eb112 introduces new start codon 5' to wt spe-10. When this start codon is used a novel 19 aa peptide is encoded before translation termination at the first in-frame stop (ochre) codon. Paper_evidence: WBPaper00026789
  Method: Substitution_allele