WormBase Tree Display for Variation: WBVar00145064
expand all nodes | collapse all nodes | view schema
WBVar00145064 | Evidence | Paper_evidence | WBPaper00006130 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | eb9 | ||||||
Other_name | ZC404.3a.1:c.1000C>T | |||||||
ZC404.3b.1:c.*738C>T | ||||||||
CE07594:p.Arg334Ter | ||||||||
ZC404.3b.2:c.*738C>T | ||||||||
HGVSg | CHROMOSOME_V:g.6786857C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC404 | ||||
Flanking_sequences | atggatgctggagataaaggagaacatttc | gaaagtttccaaaaaccagctctctaattg | ||||||
Mapping_target | ZC404 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006130 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034097 | |||||||
Laboratory | SL | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004975 | ||||||
Transcript | ZC404.3b.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZC404.3b.1:c.*738C>T | |||||||
cDNA_position | 1027 | |||||||
Exon_number | 8/11 | |||||||
ZC404.3a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZC404.3a.1:c.1000C>T | |||||||
HGVSp | CE07594:p.Arg334Ter | |||||||
cDNA_position | 1034 | |||||||
CDS_position | 1000 | |||||||
Protein_position | 334 | |||||||
Exon_number | 7/11 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZC404.3b.2 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZC404.3b.2:c.*738C>T | |||||||
cDNA_position | 1033 | |||||||
Exon_number | 8/10 | |||||||
Interactor | WBInteraction000504542 | |||||||
Genetics | Interpolated_map_position | V | 0.263677 | |||||
Description | Phenotype | WBPhenotype:0001423 | Paper_evidence | WBPaper00032464 | ||||
Curator_confirmed | WBPerson725 | |||||||
Remark | accumulates more yolk granules than the wild type control suggesting that processing is defective | Paper_evidence | WBPaper00032464 | |||||
Curator_confirmed | WBPerson725 | |||||||
coelomocytes in spe-39(eb9) accumulate more yolk than the wild type control suggesting defects in yolk degradation | Paper_evidence | WBPaper00032464 | ||||||
Curator_confirmed | WBPerson725 | |||||||
Phenotype_assay | Genotype | bIs1 [Pvit-2::VIT-2::GFP; rol-6(su1006)] | Paper_evidence | WBPaper00032464 | ||||
Curator_confirmed | WBPerson725 | |||||||
Reference | WBPaper00006130 | |||||||
WBPaper00032464 | ||||||||
Method | Substitution_allele |