WormBase Tree Display for Variation: WBVar00144920
expand all nodes | collapse all nodes | view schema
WBVar00144920 | Evidence | Paper_evidence | WBPaper00026735 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2689 | |||||||
Other_name | M02B1.1a.1:c.388C>T | ||||||||
M02B1.1c.1:c.16C>T | |||||||||
M02B1.1b.1:c.268C>T | |||||||||
CE43555:p.Gln130Ter | |||||||||
CE45668:p.Gln6Ter | |||||||||
CE37656:p.Gln90Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.12851646C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | M02B1 | |||||
Flanking_sequences | gtttgcattcccgccatgatctacatagtt | aaaataatcttttctacgtggcagcttcac | |||||||
Mapping_target | M02B1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00013440 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004702 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00005153 | |||||||
Transcript | M02B1.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | M02B1.1b.1:c.268C>T | ||||||||
HGVSp | CE37656:p.Gln90Ter | ||||||||
cDNA_position | 268 | ||||||||
CDS_position | 268 | ||||||||
Protein_position | 90 | ||||||||
Exon_number | 3/6 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
M02B1.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M02B1.1a.1:c.388C>T | ||||||||
HGVSp | CE43555:p.Gln130Ter | ||||||||
cDNA_position | 400 | ||||||||
CDS_position | 388 | ||||||||
Protein_position | 130 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
M02B1.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M02B1.1c.1:c.16C>T | ||||||||
HGVSp | CE45668:p.Gln6Ter | ||||||||
cDNA_position | 16 | ||||||||
CDS_position | 16 | ||||||||
Protein_position | 6 | ||||||||
Exon_number | 1/4 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000008514 | ||||||||
Genetics | Interpolated_map_position | IV | 6.37322 | ||||||
Description | Phenotype | WBPhenotype:0001413 | Paper_evidence | WBPaper00026735 | |||||
WBPaper00024246 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | 0% animals have a deformed anal region (Dar) (20C, n=460). | Paper_evidence | WBPaper00024246 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006919 | PATO:0000460 | Paper_evidence | WBPaper00024246 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on plates containing Microbacterium nematophilum strain CBX102. | Paper_evidence | WBPaper00024246 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00024246 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001420 | Paper_evidence | WBPaper00024246 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As assayed by DIC microscopy for the presence of biofilm adherent to the head of the animal, in addition to assaying the number animals that reached L4 after two days of growth at 20. 100% reach L4 after two days at 20C (n=725). | Paper_evidence | WBPaper00024246 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on plates containing Yersinia pseudotuberculosis. | Paper_evidence | WBPaper00024246 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001384 | Paper_evidence | WBPaper00024246 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Brood sizes were not significantly different between populations of mutants grown on E.coli versus grown on M. nematophilum, whereas there is a 50% decrease in brood size for N2 worms. | Paper_evidence | WBPaper00024246 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on plates containing 0.1% Microbacterium nematophilum CBX102. | Paper_evidence | WBPaper00024246 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00024246 | ||||||||
WBPaper00026735 | |||||||||
WBPaper00065859 | |||||||||
Method | Substitution_allele |