WormBase Tree Display for Variation: WBVar00144428
expand all nodes | collapse all nodes | view schema
WBVar00144428 | Evidence | Paper_evidence | WBPaper00005045 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1959 | |||||
Other_name | Y54E10A.4a.1:c.-32C>T | ||||||
Y54E10A.4b.1:c.611C>T | |||||||
Y54E10A.4a.2:c.-32C>T | |||||||
CE27480:p.Ser204Phe | |||||||
HGVSg | CHROMOSOME_I:g.3213086C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10A | |||
Flanking_sequences | atcggaacgagaacaatcaacgagtcgtct | caacaaagtattcgttggtggaatctcgca | |||||
Mapping_target | Y54E10A | ||||||
Type_of_mutation | Substitution | c | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001481 | |||||
Transcript | Y54E10A.4a.1 | VEP_consequence | 5_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y54E10A.4a.1:c.-32C>T | ||||||
cDNA_position | 623 | ||||||
Exon_number | 5/11 | ||||||
Y54E10A.4b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
HGVSc | Y54E10A.4b.1:c.611C>T | ||||||
HGVSp | CE27480:p.Ser204Phe | ||||||
cDNA_position | 623 | ||||||
CDS_position | 611 | ||||||
Protein_position | 204 | ||||||
Exon_number | 6/10 | ||||||
Codon_change | tCc/tTc | ||||||
Amino_acid_change | S/F | ||||||
Y54E10A.4a.2 | VEP_consequence | 5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y54E10A.4a.2:c.-32C>T | ||||||
cDNA_position | 97 | ||||||
Exon_number | 1/7 | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | I | -4.47298 | ||||
Mapping_data | In_2_point | 2502 | |||||
In_multi_point | 976 | ||||||
977 | |||||||
978 | |||||||
Description | Phenotype | WBPhenotype:0000687 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | homozygous XX animals transformed into fertile females; homozygous XO animals are somatically male, make oocytes in germ line; heterozygous XO animals are somatically male with both sperm and oocytes in germline. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00016427 | ||||||
WBPaper00016310 | |||||||
Method | Substitution_allele |