WormBase Tree Display for Variation: WBVar00144267
expand all nodes | collapse all nodes | view schema
WBVar00144267 | Evidence | Paper_evidence | WBPaper00004503 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1735 | |||||||
Other_name | Y47H9C.4b.1:c.1123C>T | ||||||||
CE20264:p.Gln375Ter | |||||||||
CE30362:p.Gln375Ter | |||||||||
Y47H9C.4c.1:c.1123C>T | |||||||||
CE30361:p.Gln375Ter | |||||||||
Y47H9C.4a.1:c.1123C>T | |||||||||
HGVSg | CHROMOSOME_I:g.11860931G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47H9C | |||||
Flanking_sequences | aaatgtgacgaacgaaaatgcgatgcggag | aatacggcgcagattgctccaaaacgtgta | |||||||
Mapping_target | Y47H9C | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (13) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000415 | |||||||
Transcript | Y47H9C.4a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4a.1:c.1123C>T | ||||||||
HGVSp | CE20264:p.Gln375Ter | ||||||||
cDNA_position | 1129 | ||||||||
CDS_position | 1123 | ||||||||
Protein_position | 375 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y47H9C.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4c.1:c.1123C>T | ||||||||
HGVSp | CE30362:p.Gln375Ter | ||||||||
cDNA_position | 1129 | ||||||||
CDS_position | 1123 | ||||||||
Protein_position | 375 | ||||||||
Exon_number | 7/12 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y47H9C.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4b.1:c.1123C>T | ||||||||
HGVSp | CE30361:p.Gln375Ter | ||||||||
cDNA_position | 1129 | ||||||||
CDS_position | 1123 | ||||||||
Protein_position | 375 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (28) | |||||||||
Genetics | Interpolated_map_position | I | 12.8808 | ||||||
Mapping_data (2) | |||||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0000072 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no gross phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001190 | Paper_evidence | WBPaper00032003 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No difference in pumping rates were perceived between mutant and wild-type animals. Expression levels of pharyngeal genes were not significantly different from expression levels observed for wild-type animals. No S. enterica invasion was noted during early infection. | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | A total of 20 ml of culture was plated onto a 3.5 cm plate containing modified NGM (3.5% peptone instead of 2.5%). Synchronized one-day-old adult hermaphroditic nematodes were transferred to lawns of the various bacteria and transferred daily to a fresh lawn until progeny were no longer produced. | Paper_evidence | WBPaper00032003 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (23) | |||||||||
Method | Substitution_allele |