WormBase Tree Display for Variation: WBVar00144042
expand all nodes | collapse all nodes | view schema
WBVar00144042 | Evidence | Paper_evidence | WBPaper00002482 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1494 | |||||
Other_name | CE05481:p.Gly315Glu | ||||||
C50H2.3a.1:c.944G>A | |||||||
HGVSg | CHROMOSOME_V:g.9913052C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C50H2 | |||
Flanking_sequences | gtacttgtctagaaggatacgcaggaaatg | atataactgtacagtttctaaaagtcagcg | |||||
Mapping_target | C50H2 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002482 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004348 | ||||||
WBStrain00006234 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003173 | |||||
Transcript | C50H2.3a.1 (12) | ||||||
Genetics | Interpolated_map_position | V | 2.21131 | ||||
Mapping_data | In_2_point | 133 | |||||
In_multi_point | 284 | ||||||
3103 | |||||||
3104 | |||||||
In_pos_neg_data | 495 | ||||||
1747 | |||||||
1751 | |||||||
3124 | |||||||
3125 | |||||||
3126 | |||||||
3127 | |||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00030928 | |||||
Curator_confirmed | WBPerson48753 | ||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||
Curator_confirmed | WBPerson48753 | ||||||
WBPhenotype:0002592 | Paper_evidence | WBPaper00030928 | |||||
Curator_confirmed | WBPerson48753 | ||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||
Curator_confirmed | WBPerson48753 | ||||||
Phenotype_not_observed | WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | ||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00000502 | ||||||
WBPaper00003680 | |||||||
WBPaper00003408 | |||||||
WBPaper00030928 | |||||||
Method | Substitution_allele |