WormBase Tree Display for Variation: WBVar00143988
expand all nodes | collapse all nodes | view schema
WBVar00143988 | Evidence | Paper_evidence | WBPaper00002436 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1413 | |||||||
Other_name | Y54G11A.10b.1:c.40C>T | ||||||||
Y54G11A.10a.1:c.40C>T | |||||||||
CE43616:p.Gln14Ter | |||||||||
CE43589:p.Gln14Ter | |||||||||
HGVSg | CHROMOSOME_II:g.14348753G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y54G11A | |||||
Flanking_sequences | ccggatggtccgaatttggagcgggacgtt | agcgtattctagagctcatggagcacgttc | |||||||
Mapping_target | Y54G11A | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002436 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004327 | ||||||||
WBStrain00004774 | |||||||||
WBStrain00005495 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002996 | |||||||
Transcript | Y54G11A.10b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y54G11A.10b.1:c.40C>T | ||||||||
HGVSp | CE43616:p.Gln14Ter | ||||||||
cDNA_position | 364 | ||||||||
CDS_position | 40 | ||||||||
Protein_position | 14 | ||||||||
Exon_number | 3/6 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Y54G11A.10a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y54G11A.10a.1:c.40C>T | ||||||||
HGVSp | CE43589:p.Gln14Ter | ||||||||
cDNA_position | 40 | ||||||||
CDS_position | 40 | ||||||||
Protein_position | 14 | ||||||||
Exon_number | 1/5 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000000344 | ||||||||
WBInteraction000501565 | |||||||||
Genetics | Interpolated_map_position | II | 22.9071 | ||||||
Mapping_data | In_2_point | 493 | |||||||
4226 | |||||||||
4227 | |||||||||
5206 | |||||||||
5209 | |||||||||
5210 | |||||||||
In_multi_point | 413 | ||||||||
1396 | |||||||||
1675 | |||||||||
1833 | |||||||||
1834 | |||||||||
Description | Phenotype | WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||
WBPaper00002375 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 28 percent of the Vul hermaphrodites have 1 or more ventral protrusions. The penetrance of the Vul phenotype decreases in e1413 hermaphrodites that do not pass through dauer stage but have been starved before reaching adulthood | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
On average only one VPC adopts a vulval fate. | Paper_evidence | WBPaper00002375 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Adult hermaphrodite vulvaless (penetrance 98%). | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
98% | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 98 | 98 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000784 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult male wildtype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001987 | Paper_evidence | WBPaper00001039 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals contained normal levels of AChE activity. | Paper_evidence | WBPaper00001039 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001039 | ||||||||
WBPaper00014218 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00002375 | |||||||||
WBPaper00011626 | |||||||||
WBPaper00013667 | |||||||||
WBPaper00015978 | |||||||||
WBPaper00014517 | |||||||||
WBPaper00023121 | |||||||||
WBPaper00013920 | |||||||||
Method | Substitution_allele |