WormBase Tree Display for Variation: WBVar00143962
expand all nodes | collapse all nodes | view schema
WBVar00143962 | Evidence | Paper_evidence | WBPaper00035610 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1385 | ||||||
Other_name | W01G7.1.2:c.1264C>T | |||||||
W01G7.1.1:c.1264C>T | ||||||||
CE18985:p.Gln422Ter | ||||||||
HGVSg | CHROMOSOME_II:g.14035095G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | W01G7 | ||||
Flanking_sequences | gagtccgatttcacacataaagtcgtcacg | agcagcaagaatggaaggcaaagatgaagg | ||||||
Mapping_target | W01G7 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004316 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000901 | ||||||
Transcript | W01G7.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | W01G7.1.1:c.1264C>T | |||||||
HGVSp | CE18985:p.Gln422Ter | |||||||
cDNA_position | 1271 | |||||||
CDS_position | 1264 | |||||||
Protein_position | 422 | |||||||
Exon_number | 5/7 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
W01G7.1.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | W01G7.1.2:c.1264C>T | |||||||
HGVSp | CE18985:p.Gln422Ter | |||||||
cDNA_position | 1408 | |||||||
CDS_position | 1264 | |||||||
Protein_position | 422 | |||||||
Exon_number | 6/8 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000518711 | |||||||
WBInteraction000536045 | ||||||||
WBInteraction000536049 | ||||||||
WBInteraction000536054 | ||||||||
WBInteraction000536057 | ||||||||
Genetics | Interpolated_map_position | II | 22.3112 | |||||
Description | Phenotype | WBPhenotype:0001090 | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "A mutation in daf-5 also significantly reduces thermotolerance of daf-2(e1370) worms at 37C (Figure S13)." | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Figure S13C | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "A mutation in daf-5 also decreased the increased lifespan of age-1(hx546) worms, with age-1(hx546); daf-5(e1385) double mutants living significantly shorter than the parental strain (Figure S13)." | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | age-1(hx546) | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Similarly, age-1(hx546); daf-5(e1385) had less fat than age-1(hx546) worms (Figure S12)." | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | age-1(hx546) | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | In daf-5 mutants, there were no significant changes in the expression of the daf genes tested | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | qRT-PCR | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The mitotic region of daf-5(e1385) was indistinguishable from that of the wild type | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00038374 | |||||||
WBPaper00035610 | ||||||||
Method | Substitution_allele |