WormBase Tree Display for Variation: WBVar00143898
expand all nodes | collapse all nodes | view schema
WBVar00143898 | Evidence | Person_evidence | WBPerson10095 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1295 | |||||
Other_name | F54D8.1.1:c.329dup | ||||||
CE11066:p.Thr111AsnfsTer57 | |||||||
HGVSg | CHROMOSOME_III:g.5107661dup | ||||||
Sequence_details | SMap | S_parent | Sequence | F54D8 | |||
Flanking_sequences | cccaggaaatactggatcatcgaacacccc | aactcttccaggagttattggagttccacc | |||||
Mapping_target | F54D8 | ||||||
Type_of_mutation | Insertion | C | |||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004292 | ||||||
WBStrain00057840 | |||||||
WBStrain00057844 | |||||||
WBStrain00057846 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001076 | |||||
Transcript | F54D8.1.1 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F54D8.1.1:c.329dup | ||||||
HGVSp | CE11066:p.Thr111AsnfsTer57 | ||||||
cDNA_position | 332-333 | ||||||
CDS_position | 329-330 | ||||||
Protein_position | 110 | ||||||
Exon_number | 2/4 | ||||||
Codon_change | cca/ccCa | ||||||
Amino_acid_change | P/PX | ||||||
Genetics | Interpolated_map_position | III | -2.1354 | ||||
Description | Phenotype | WBPhenotype:0000124 | Paper_evidence | WBPaper00042218 | |||
Curator_confirmed | WBPerson21339 | ||||||
Remark | mutant lacks C-mannosyltransferase activity, based on enzymatic assays with worm extract. | Paper_evidence | WBPaper00042218 | ||||
Curator_confirmed | WBPerson21339 | ||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033444 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00032446 | ||||||
WBPaper00033444 | |||||||
WBPaper00015216 | |||||||
WBPaper00042218 | |||||||
WBPaper00066195 | |||||||
Remark | Variation information submitted by WBPerson10095 on 2022-02-17_11:25:16 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||
alt_det = insert one C, Frameshift | Person_evidence | WBPerson10095 | |||||
Curator_confirmed | WBPerson51134 | ||||||
Method | Insertion_allele |