WormBase Tree Display for Variation: WBVar00143814
expand all nodes | collapse all nodes | view schema
WBVar00143814 | Evidence | Person_evidence | WBPerson14476 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1189 | |||||
Other_name | Y60A3A.1.1:c.1875del | ||||||
CE24516:p.Ala626ProfsTer63 | |||||||
HGVSg | CHROMOSOME_V:g.19997759del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | |||
Flanking_sequences | CCATCTCGCAGCAGGATTCAAGAAGACCCC | GCCGAGGTTCCAATGGATCACGGAGCCCTA | |||||
Mapping_target | Y60A3A | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004264 | ||||||
WBStrain00022534 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006786 | |||||
Transcript | Y60A3A.1.1 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y60A3A.1.1:c.1875del | ||||||
HGVSp | CE24516:p.Ala626ProfsTer63 | ||||||
cDNA_position | 1940 | ||||||
CDS_position | 1875 | ||||||
Protein_position | 625 | ||||||
Exon_number | 8/11 | ||||||
Codon_change | ccC/cc | ||||||
Amino_acid_change | P/X | ||||||
Interactor | WBInteraction000518879 | ||||||
WBInteraction000520369 | |||||||
WBInteraction000524858 | |||||||
WBInteraction000524859 | |||||||
Isolation | Mutagen | EMS | |||||
Forward_genetics | |||||||
Genetics | Interpolated_map_position | V | 24.4155 | ||||
Mapping_data | In_multi_point | 3425 | |||||
3426 | |||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00041842 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Figure 6A, S5C | Paper_evidence | WBPaper00041842 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001181 | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | The unc-51(e1189) mutation resulted in a significant increase in the number of cell corpses observed in embryos (Table 1) | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals were isolated based on altered or fewer muscle arms, observed by an altered pattern of trIs25 reporter expression, which expresses membrane-anchored YFP in select muscles of only the distal row of body wall muscles. These mutants exhibited dramatically more defective dorsal muscle arm extension than ventral arm extension, unlike the majority of mutants isolated in the same screen. | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000885 | Paper_evidence | WBPaper00050047 | ||||
Curator_confirmed | WBPerson7492 | ||||||
Remark | midbody phagocytosis normal | Paper_evidence | WBPaper00050047 | ||||
Curator_confirmed | WBPerson7492 | ||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00050047 | |||||
Curator_confirmed | WBPerson7492 | ||||||
Remark | midbody phagosome maturation normal | Paper_evidence | WBPaper00050047 | ||||
Curator_confirmed | WBPerson7492 | ||||||
Reference | WBPaper00041842 | ||||||
WBPaper00032446 | |||||||
WBPaper00015216 | |||||||
WBPaper00032907 | |||||||
WBPaper00044390 | |||||||
WBPaper00050047 | |||||||
Method | Deletion_allele |