WormBase Tree Display for Variation: WBVar00143086
expand all nodes | collapse all nodes | view schema
WBVar00143086 | Evidence | Paper_evidence | WBPaper00004985 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e284 | |||||
Other_name | CE17307:p.Glu98Lys | ||||||
ZC416.8b.1:c.-1+1452G>A | |||||||
ZC416.8a.1:c.292G>A | |||||||
HGVSg | CHROMOSOME_IV:g.3623180C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | |||
Flanking_sequences | gaggtcggcggaaggattaactttttggat | aggagctggaattgggatggctcttcgctt | |||||
Mapping_target | ZC416 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004985 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene (2) | ||||||
Transcript | ZC416.8a.1 (12) | ||||||
ZC416.8b.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | ZC416.8b.1:c.-1+1452G>A | ||||||
Intron_number | 1/11 | ||||||
Genetics | Interpolated_map_position | IV | -3.08595 | ||||
Reference | WBPaper00004985 | ||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 98 E to K Inferred_automatically map_Alleles.pl | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 | |||||||
Method | Substitution_allele |