WormBase Tree Display for Variation: WBVar00142964
expand all nodes | collapse all nodes | view schema
WBVar00142964 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e107 | |||
Other_name | F59E12.2.1:c.1310+694C>T | ||||
CE11540:p.Gly127Arg | |||||
F59E12.12.1:c.379G>A | |||||
HGVSg | CHROMOSOME_II:g.5651996C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | |
Flanking_sequences | taccatcccgtccatcttctcctggtggtc | tggtggtccagatggtccggttttgcaaga | |||
Mapping_target | F59E12 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051522 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00000252 | |||
WBGene00006988 | |||||
Transcript | F59E12.12.1 (12) | ||||
F59E12.2.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F59E12.2.1:c.1310+694C>T | ||||
Intron_number | 5/8 | ||||
Genetics | Interpolated_map_position | II | -0.987964 | ||
Remark | alt_det = g to a mut_det = G127R | Person_evidence | WBPerson10095 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson10095 on 2022-02-17_15:42:04 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |