WormBase Tree Display for Variation: WBVar00142961
expand all nodes | collapse all nodes | view schema
WBVar00142961 | Evidence | Paper_evidence | WBPaper00004891 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e102 | |||||||
Other_name | T10A3.1a.1:c.2207+1G>A | ||||||||
T10A3.1d.1:c.2162+1G>A | |||||||||
T10A3.1f.1:c.2162+1G>A | |||||||||
T10A3.1b.1:c.2207+1G>A | |||||||||
T10A3.1e.1:c.2168+1G>A | |||||||||
T10A3.1c.1:c.2168+1G>A | |||||||||
HGVSg | CHROMOSOME_X:g.7275968C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T10A3 | |||||
Flanking_sequences | tgtcgagctgattgttagtaggagtgcaat | taaatatacattttatttttaaactctgtc | |||||||
Mapping_target | T10A3 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004100 | ||||||||
WBStrain00005508 | |||||||||
WBStrain00005509 | |||||||||
WBStrain00027194 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006750 | |||||||
Transcript | T10A3.1c.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T10A3.1c.1:c.2168+1G>A | ||||||||
Intron_number | 16/28 | ||||||||
T10A3.1d.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T10A3.1d.1:c.2162+1G>A | ||||||||
Intron_number | 16/27 | ||||||||
T10A3.1e.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T10A3.1e.1:c.2168+1G>A | ||||||||
Intron_number | 16/27 | ||||||||
T10A3.1b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T10A3.1b.1:c.2207+1G>A | ||||||||
Intron_number | 15/27 | ||||||||
T10A3.1a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T10A3.1a.1:c.2207+1G>A | ||||||||
Intron_number | 16/27 | ||||||||
T10A3.1f.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T10A3.1f.1:c.2162+1G>A | ||||||||
Intron_number | 16/26 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | -1.78183 | ||||||
Mapping_data | In_2_point | 147 | |||||||
182 | |||||||||
3912 | |||||||||
3913 | |||||||||
6198 | |||||||||
In_multi_point | 164 | ||||||||
647 | |||||||||
1218 | |||||||||
1336 | |||||||||
1583 | |||||||||
1740 | |||||||||
2211 | |||||||||
2215 | |||||||||
2289 | |||||||||
2454 | |||||||||
2455 | |||||||||
2471 | |||||||||
3244 | |||||||||
In_pos_neg_data | 1855 | ||||||||
1877 | |||||||||
1892 | |||||||||
1916 | |||||||||
1932 | |||||||||
1948 | |||||||||
1964 | |||||||||
1980 | |||||||||
1996 | |||||||||
2003 | |||||||||
2012 | |||||||||
2028 | |||||||||
2044 | |||||||||
Description | Phenotype | WBPhenotype:0000019 | Paper_evidence | WBPaper00001709 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000020 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | slightly thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly small and thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000353 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tends to back | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00001709 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | weak coiler | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | fairly active | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00043908 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | loopy movement in reverse | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001289 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001622 | Paper_evidence | WBPaper00002487 | |||||||
Curator_confirmed | WBPerson554 | ||||||||
Remark | Figure 3 | Paper_evidence | WBPaper00002487 | ||||||
Curator_confirmed | WBPerson554 | ||||||||
Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00002487 | |||||
Curator_confirmed | WBPerson554 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001852 | Paper_evidence | WBPaper00035074 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are susceptible to tribendimidine | Paper_evidence | WBPaper00035074 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002293 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002308 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002335 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002347 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002382 | Paper_evidence | WBPaper00048427 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Phenotype_assay | Genotype | dvIs19 [Pgst-4::GFP::NLS] | Paper_evidence | WBPaper00048427 | |||||
Curator_confirmed | WBPerson11689 | ||||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00035074 | |||||||||
WBPaper00001709 | |||||||||
WBPaper00028886 | |||||||||
WBPaper00015500 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00002487 | |||||||||
WBPaper00015253 | |||||||||
WBPaper00045955 | |||||||||
WBPaper00048427 | |||||||||
Method | Substitution_allele |