WormBase Tree Display for Variation: WBVar00142960
expand all nodes | collapse all nodes | view schema
WBVar00142960 | Evidence | Person_evidence | WBPerson21026 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e101 | ||||||
Other_name | R12H7.1a.2:c.1039-1G>A | |||||||
R12H7.1a.1:c.1039-1G>A | ||||||||
R12H7.1b.1:c.847-1G>A | ||||||||
HGVSg | CHROMOSOME_X:g.13215704G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R12H7 | ||||
Flanking_sequences | ttacactgaccgaaattaaaccccatttca | gatggtgttttcctacttcgtatggttgca | ||||||
Mapping_target | R12H7 | |||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson21026 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004099 | |||||||
WBStrain00027005 | ||||||||
WBStrain00027143 | ||||||||
WBStrain00034124 | ||||||||
WBStrain00034336 | ||||||||
WBStrain00034605 | ||||||||
WBStrain00035117 | ||||||||
WBStrain00035118 | ||||||||
WBStrain00035119 | ||||||||
WBStrain00035120 | ||||||||
WBStrain00035121 | ||||||||
WBStrain00035122 | ||||||||
WBStrain00035123 | ||||||||
WBStrain00035124 | ||||||||
WBStrain00035125 | ||||||||
WBStrain00056101 | ||||||||
WBStrain00056104 | ||||||||
WBStrain00056127 | ||||||||
WBStrain00056155 | ||||||||
Laboratory | CB | |||||||
OJ | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006749 | ||||||
Transcript | R12H7.1a.2 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R12H7.1a.2:c.1039-1G>A | |||||||
Intron_number | 9/10 | |||||||
R12H7.1a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R12H7.1a.1:c.1039-1G>A | |||||||
Intron_number | 8/9 | |||||||
R12H7.1b.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R12H7.1b.1:c.847-1G>A | |||||||
Intron_number | 5/5 | |||||||
Interactor | WBInteraction000052321 | |||||||
WBInteraction000052323 | ||||||||
WBInteraction000052325 | ||||||||
WBInteraction000518927 | ||||||||
WBInteraction000518931 | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | 10.3258 | |||||
Mapping_data | In_2_point | 179 | ||||||
189 | ||||||||
190 | ||||||||
419 | ||||||||
3666 | ||||||||
3914 | ||||||||
5007 | ||||||||
6063 | ||||||||
6105 | ||||||||
6123 | ||||||||
6161 | ||||||||
In_multi_point | 426 | |||||||
442 | ||||||||
445 | ||||||||
617 | ||||||||
620 | ||||||||
735 | ||||||||
751 | ||||||||
1325 | ||||||||
1326 | ||||||||
1352 | ||||||||
1436 | ||||||||
1437 | ||||||||
1438 | ||||||||
1562 | ||||||||
1563 | ||||||||
1564 | ||||||||
1738 | ||||||||
1742 | ||||||||
1770 | ||||||||
1774 | ||||||||
1776 | ||||||||
2060 | ||||||||
2062 | ||||||||
2063 | ||||||||
2064 | ||||||||
2168 | ||||||||
2171 | ||||||||
2292 | ||||||||
2411 | ||||||||
3080 | ||||||||
3085 | ||||||||
3086 | ||||||||
3089 | ||||||||
3091 | ||||||||
3093 | ||||||||
In_pos_neg_data | 944 | |||||||
1853 | ||||||||
1878 | ||||||||
1895 | ||||||||
1903 | ||||||||
1918 | ||||||||
1934 | ||||||||
1950 | ||||||||
1966 | ||||||||
1982 | ||||||||
1998 | ||||||||
2005 | ||||||||
2014 | ||||||||
2030 | ||||||||
2046 | ||||||||
2185 | ||||||||
2240 | ||||||||
2258 | ||||||||
5507 | ||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson21026 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000543 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Moves backward better than forward slight kinker in forward movement. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000641 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Active, healthy. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00000958 | ||||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | unc-9 is required for the even distribution of GFP::SYD-2 and UNC-10 active zone markers | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001364 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male fan slightly reduced. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001522 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male spicules tend to protrude. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002292 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002310 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002335 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002344 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002347 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002348 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001611 | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit normal halothane sensitivity. | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001612 | Paper_evidence | WBPaper00002358 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have a similar EC50 (1020 30mM) compared to N2 (1050 25 mM). | Paper_evidence | WBPaper00002358 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | 50 animals were scored for mobility for 10 sec. at each concentration of ethanol after 5 min exposure. EC50's (concentration at which 50% of the animals were immobile for >10 sec) were determined from a dose response curve over a minimum of 12 concentrations (mM). Immobility was used an as endpoint. Upon removal from ethanol, immobility was reversible within 10-15 min. Treatment and scoring of anesthetic responses are described in Sedensky and Meneely, 1987; Morgan et al. , 1990; Morgan and Sedensky, 1994. | Paper_evidence | WBPaper00002358 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22-24C | Paper_evidence | WBPaper00002358 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00013842 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00000958 | ||||||||
WBPaper00016500 | ||||||||
WBPaper00002358 | ||||||||
WBPaper00025689 | ||||||||
WBPaper00033075 | ||||||||
WBPaper00065757 | ||||||||
WBPaper00066448 | ||||||||
Method | Substitution_allele |