WormBase Tree Display for Variation: WBVar00142816
expand all nodes | collapse all nodes | view schema
WBVar00142816 | Evidence | Paper_evidence | WBPaper00005054 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | dh6 | |||||||
Other_name | CE53632:p.Gln225Ter | ||||||||
T13C5.1c.1:c.673C>T | |||||||||
CE30451:p.Gln246Ter | |||||||||
T13C5.1a.1:c.781C>T | |||||||||
T13C5.1b.1:c.736C>T | |||||||||
CE27206:p.Gln261Ter | |||||||||
HGVSg | CHROMOSOME_X:g.6199421C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T13C5 | |||||
Flanking_sequences | cttgctggagcgattgctaatgtgattcaa | aaatcactattggacgcaattacatgtacc | |||||||
Mapping_target | T13C5 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000019 | ||||||||
Laboratory | AA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000905 | |||||||
Transcript | T13C5.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T13C5.1c.1:c.673C>T | ||||||||
HGVSp | CE53632:p.Gln225Ter | ||||||||
cDNA_position | 673 | ||||||||
CDS_position | 673 | ||||||||
Protein_position | 225 | ||||||||
Exon_number | 4/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
T13C5.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T13C5.1b.1:c.736C>T | ||||||||
HGVSp | CE30451:p.Gln246Ter | ||||||||
cDNA_position | 736 | ||||||||
CDS_position | 736 | ||||||||
Protein_position | 246 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
T13C5.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T13C5.1a.1:c.781C>T | ||||||||
HGVSp | CE27206:p.Gln261Ter | ||||||||
cDNA_position | 842 | ||||||||
CDS_position | 781 | ||||||||
Protein_position | 261 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000004712 | ||||||||
WBInteraction000005471 | |||||||||
WBInteraction000517971 | |||||||||
WBInteraction000532938 | |||||||||
Genetics | Interpolated_map_position | X | -3.46627 | ||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00027611 | |||||
WBPaper00037672 | |||||||||
WBPaper00024451 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Endogenous dafachronic acid (DA) production is eliminated by the daf-9(dh6) mutation, resulting in 100% dauer formation. This phenotype can be rescued by exogenous DA [(25S),26-3-keto-4-cholestenoic acid] added to the medium. | Paper_evidence | WBPaper00037672 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Figure 3A | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00037672 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
100 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0040024 | PATO:0000460 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000077 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Partial reduction of daf-9 function results in animals that bypass the dauer stage yet exhibit abnormal gonadal morphogenesis and migration (Mig; WBPhenotype:0000594) and occasionally aberrant cuticle shedding (Cut; WBPhenotype: 0000077) defects (Figure 2A) [18,19]." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 10nM dafachronic acid | Paper_evidence | WBPaper00040979 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000083 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 2A,2D | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 10nM dafachronic acid | Paper_evidence | WBPaper00040979 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000138 | Paper_evidence | WBPaper00034639 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In daf-9-deficient dauer-like larvae, 4-MS are highly increased in comparison to N2 | Paper_evidence | WBPaper00034639 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000447 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Most daf-9(dh6) null animals developed into abnormal adults when supplemented with a minimum of 10 nM DA (Figure 2B, 74% +/- 42% non-dauers), suggesting that a threshold of DA has to be crossed before committing to adult fate (dauer bypass DA threshold)." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 10nM dafachronic acid | Paper_evidence | WBPaper00040979 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00032886 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rescue of the dauer phenotype was assayed with various dafachronic acid isomers. | Paper_evidence | WBPaper00032886 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032886 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dhEx24 | Paper_evidence | WBPaper00032886 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Partial reduction of daf-9 function results in animals that bypass the dauer stage yet exhibit abnormal gonadal morphogenesis and migration (Mig; WBPhenotype:0000594) and occasionally aberrant cuticle shedding (Cut; WBPhenotype: 0000077) defects (Figure 2A) [18,19]." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 10nM dafachronic acid | Paper_evidence | WBPaper00040979 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00027611 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00024451 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 6D,K | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000046 | PATO:0000460 | Paper_evidence | WBPaper00024451 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Fat staining performed with Nile Red | Paper_evidence | WBPaper00024451 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00024451 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00040979 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Partial reduction of daf-9 function results in animals that bypass the dauer stage yet exhibit abnormal gonadal morphogenesis and migration (Mig; WBPhenotype:0000594) and occasionally aberrant cuticle shedding (Cut; WBPhenotype: 0000077) defects (Figure 2A) [18,19]." | Paper_evidence | WBPaper00040979 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00024451 | ||||||||
WBPaper00040979 | |||||||||
WBPaper00027611 | |||||||||
WBPaper00034639 | |||||||||
WBPaper00037672 | |||||||||
WBPaper00032886 | |||||||||
Method | Substitution_allele |