WormBase Tree Display for Variation: WBVar00094610
expand all nodes | collapse all nodes | view schema
WBVar00094610 | Evidence | Paper_evidence | WBPaper00004137 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | om18 | |||||||
Other_name | F26A3.3.1:c.790-1G>A | ||||||||
HGVSg | CHROMOSOME_I:g.7655270C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26A3 | |||||
Flanking_sequences | atcgaaataagatgttaattacaattttca | gaaaatcggcactccgtcccacattatcga | |||||||
Mapping_target | F26A3 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | EL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001214 | |||||||
Transcript | F26A3.3.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F26A3.3.1:c.790-1G>A | ||||||||
Intron_number | 5/16 | ||||||||
Interactor | WBInteraction000518988 | ||||||||
Genetics | Interpolated_map_position | I | 2.21448 | ||||||
Mapping_data | In_multi_point | 3349 | |||||||
3350 | |||||||||
3351 | |||||||||
3352 | |||||||||
3353 | |||||||||
Description | Phenotype | WBPhenotype:0000356 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | delayed spermatogenesis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000684 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | reduced germ cell number, 50% of wild type in young adult | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000894 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In ego-1 animals, transition nuclei were visible several hours earlier than in controls | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001260 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal unfertilized oocytes | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001567 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ego-1 mutants had large, diffusely staining nuclei in the distal arm of the gonad that were not found in controls | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00004137 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001694 | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The spermatogenesis-to-oogenesis switch occurred several hours later in ego-1 mutants than in controls | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004137 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004137 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004137 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00004137 | ||||||||
WBPaper00022067 | |||||||||
WBPaper00011141 | |||||||||
WBPaper00015554 | |||||||||
WBPaper00010940 | |||||||||
WBPaper00015000 | |||||||||
Method | Substitution_allele |