WormBase Tree Display for Variation: WBVar00092675

WBVar00092675 Name: Public_name: ok1461
    Other_name: B0272.1.1:c.166+81_946delinsAC
    HGVSg: CHROMOSOME_X:g.9435145_9436599delinsGT
  Sequence_details: SMap: S_parent: Sequence: B0272
    Flanking_sequences: cttctttcatgctcattcttccgcggaaca agtagtatttttgaagagtcaatagtgaaa
    Mapping_target: B0272
    Type_of_mutation: Insertion: GT
      Deletion
    PCR_product: ok1461_external
      ok1461_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036287
      WBStrain00056608
      WBStrain00056609
    Laboratory: RB
      CZ
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006538
    Transcript: B0272.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0272.1.1:c.166+81_946delinsAC
        cDNA_position: ?-948
        CDS_position: ?-946
        Protein_position: ?-316
        Intron_number: 3-6/8
        Exon_number: 4-7/9
    Interactor: WBInteraction000504815
      WBInteraction000504816
  Isolation: Mutagen: EMS
  Genetics: Mapping_data: In_multi_point: 5208
  Description: Phenotype: WBPhenotype:0000615 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: In tbb-4 mutants, 28% (n=36) of CEM cilia, visualized withKLP-6::GFP, appeared abnormal, often with a distorted base. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: While distal TBA-6::YFP localization was apparent in 81% (n=69) of rays in wild-type animals, this frequency was reduced to 60% (n=87) in tbb-4 mutants. | In tbb-4 mutants, the frequency of TBA-9::YFP distal localization was reduced (41%, n=46) and accumulation in large 'beads-on-a-string' -like dendritic varicosities was observed. | In wild-type controls, 56% of rays (n=88) had detectable PKD-2::GFP in the RnB cilium tips. This frequently was significantly reduced in tubulin mutants. tbb-4 mutants had a more severe phenotype than tba-6: only 37% exhibited transition zone enrichment, while 54% showed PKD-2::GFP localization throughout the dendrite without specific TZ enrichment. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0001221 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: A significant reduction was observed in the response of mutants to nose touch when compared to wild-type controls. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Uptake of the dye DiD by amphid and phasmid neurons was not grossly compromised; however, the soma of amphid neurons sometimes stained more weakly in tbb-4 (data not shown) and tba-9 tbb-4 (Figure 4A) animals than in controls. In these neurons, dendrites often exhibited large varicosities, and foci of dye accumulation were seen in cell bodies. In addition, the ASI amphid neuron sometimes failed to fill with dye. Similar results were obtained when the IL2 neurons were labeled with DiO in the presence of calcium acetate. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0004006 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Mutant males responded with a frequency of 60%. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000649 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Males that responded to contact were able to locate the hermaphrodite vulva with wild-type efficiency and mate successfully. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0001462 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: No differences were observed in the response of mutants using a four-quadrant salt chemotaxis assay compared to wild-type controls. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0001470 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: Mutants all responded robustly to the AWA-sensed odorant diacetyl (data not shown). Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
      WBPhenotype:0004017 Paper_evidence: WBPaper00036195
        Curator_confirmed: WBPerson712
        Remark: No consistent abnormalities were observed in wavelength, amplitude, frequency, or bend angle (flex) in mutants. Paper_evidence: WBPaper00036195
            Curator_confirmed: WBPerson712
  Reference: WBPaper00036195
    WBPaper00065994
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele