WormBase Tree Display for Variation: WBVar00092076
expand all nodes | collapse all nodes | view schema
WBVar00092076 | Name | Public_name | ok796 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | B0336.2.1:c.149-35_*523delinsCGAAAGAA | ||||||||
B0336.2.2:c.149-35_*523delinsCGAAAGAA | |||||||||
HGVSg | CHROMOSOME_III:g.5716302_5717441delinsCGAAAGAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0336 | |||||
Flanking_sequences | ttgggacgtttttttgttgcgaaagaacgg | ctcttctatttcgtatcgaacactgttttg | |||||||
Mapping_target | B0336 | ||||||||
Type_of_mutation | Insertion | CGAAAGAA | |||||||
Deletion | |||||||||
PCR_product | ok796_external | ||||||||
ok796_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022155 | ||||||||
WBStrain00035879 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000182 | |||||||
Transcript | B0336.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0336.2.1:c.149-35_*523delinsCGAAAGAA | ||||||||
cDNA_position | ?-1070 | ||||||||
Intron_number | 2-4/5 | ||||||||
Exon_number | 3-6/6 | ||||||||
B0336.2.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0336.2.2:c.149-35_*523delinsCGAAAGAA | ||||||||
cDNA_position | ?-1163 | ||||||||
Intron_number | 3-5/6 | ||||||||
Exon_number | 4-7/7 | ||||||||
Interactor | WBInteraction000500586 | ||||||||
WBInteraction000500587 | |||||||||
WBInteraction000500591 | |||||||||
WBInteraction000502378 | |||||||||
WBInteraction000518516 | |||||||||
WBInteraction000524009 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000216 | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed a weak extra A/PVM phenotype. | Paper_evidence | WBPaper00038432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs9[Pegl-17::gfp] | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000266 | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The cleavage furrow during the QL.p division formed towards the center of the cell rather than at the posterior, creating daughter cells that were closer in size. | Paper_evidence | WBPaper00038432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs9[Pegl-17::gfp] | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00027612 | |||||||
WBPaper00038432 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CAV-1::GFP co-localizes with Golgi marker SQV-8 in ok796 mutants and not WT as assayed by immunostaining with anti-SQV-8. Authors report identical results with CAV-2::GFP. However, RME-2::GFP localized relatively normally in cytoplasm of oocytes. | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Tagged vitellogenin (VIT-2::GFP) accumulated in the pseudocoelom. | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027612 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Immunostained with anti-SQV-8 (generated against aa 150-349) | Paper_evidence | WBPaper00027612 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | pwIS281 or pwIs281; RME-2::GFP | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
bIs1[Pvit-2::VIT-2::GFP; rol-6(su1006)] | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00027612 | |||||||
WBPaper00038432 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Reduced number of CAV-1 bodies the cytoplasm of ooctyes. Authors report identical results with CAV-2::GFP. | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Compared to wild-type oocytes, RME-2::GFP was rarely detected. | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027612 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | pwIs281 | Paper_evidence | WBPaper00027612 | |||||
Curator_confirmed | WBPerson712 | ||||||||
bIs1[Pvit-2::VIT-2::GFP; rol-6(su1006)] | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00027612 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CAV-1::GFP positive vesicles irregularly shaped. Authors report identical results with CAV-2::GFP. | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00027612 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027612 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | pwIs281 | Paper_evidence | WBPaper00027612 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001425 | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Compared to wild-type oocytes, fewer arf-1 oocytes contained VIT-2::GFP. | Paper_evidence | WBPaper00038432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | bIs1[Pvit-2::VIT-2::GFP; rol-6(su1006)] | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00038432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The cleavage furrow during the QL.p division formed towards the center of the cell rather than at the posterior, creating daughter cells that were closer in size. | Paper_evidence | WBPaper00038432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | ayIs9[Pegl-17::gfp] | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002076 | Paper_evidence | WBPaper00027612 | |||||||
Curator_confirmed | WBPerson3858 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutation did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038432 | ||||||||
WBPaper00040857 | |||||||||
WBPaper00032446 | |||||||||
WBPaper00027612 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |