WormBase Tree Display for Variation: WBVar00091626
expand all nodes | collapse all nodes | view schema
| WBVar00091626 | Name (3) | |||||||
|---|---|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | E01H11 | ||||
| Flanking_sequences | ttttcatgtttgtcttcgtttcagctcaac | atcatctacagagacttgaaattggataat | ||||||
| Mapping_target | E01H11 | |||||||
| Type_of_mutation | Insertion | ttttcag | ||||||
| Deletion | ||||||||
| PCR_product | OK328_external | |||||||
| OK328_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00035524 | |||||||
| Laboratory | RB | |||||||
| Person | WBPerson46 | |||||||
| KO_consortium_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00004033 | ||||||
| Transcript | E01H11.1f.1 (11) | |||||||
| E01H11.1c.1 (11) | ||||||||
| E01H11.1e.1 (11) | ||||||||
| E01H11.1d.1 (11) | ||||||||
| E01H11.1b.1 (11) | ||||||||
| E01H11.1a.1 (11) | ||||||||
| Interactor | WBInteraction000519488 | |||||||
| WBInteraction000519491 | ||||||||
| WBInteraction000519494 | ||||||||
| WBInteraction000519499 | ||||||||
| Genetics | Mapping_data | In_multi_point | 4587 | |||||
| Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00041109 | ||||
| Curator_confirmed | WBPerson8905 | |||||||
| Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00041109 | ||||
| Curator_confirmed | WBPerson8905 | |||||||
| WBPhenotype:0000146 | Paper_evidence | WBPaper00041109 | ||||||
| Curator_confirmed | WBPerson8905 | |||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Localization of the synaptic protein SNG-1 is normal, based on expression analysis using an SNG-1::GFP transgene. | Paper_evidence | WBPaper00028886 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| WBPhenotype:0001800 | Paper_evidence | WBPaper00033094 | ||||||
| Curator_confirmed | WBPerson2021 | |||||||
| Remark | Normal increase in pnlp-29::GFP expression after infection. Injury response is also normal (data not shown) | Paper_evidence | WBPaper00033094 | |||||
| Curator_confirmed | WBPerson2021 | |||||||
| Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
| Curator_confirmed | WBPerson2021 | |||||||
| WBPhenotype:0001838 | Paper_evidence | WBPaper00033094 | ||||||
| Curator_confirmed | WBPerson2021 | |||||||
| Remark | The PMA-induced upregulation of pnlp-29::GFP expression was normal in mutant worms | Paper_evidence | WBPaper00033094 | |||||
| Curator_confirmed | WBPerson2021 | |||||||
| Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
| Curator_confirmed | WBPerson2021 | |||||||
| Reference | WBPaper00041109 | |||||||
| WBPaper00028886 | ||||||||
| WBPaper00033094 | ||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
| Method | KO_consortium_allele |
