WormBase Tree Display for Variation: WBVar00091626
expand all nodes | collapse all nodes | view schema
WBVar00091626 | Name | Public_name | ok328 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_X:g.9380058_9382367delinsTTTTCAG | |||||||
Sequence_details | SMap | S_parent | Sequence | E01H11 | ||||
Flanking_sequences | ttttcatgtttgtcttcgtttcagctcaac | atcatctacagagacttgaaattggataat | ||||||
Mapping_target | E01H11 | |||||||
Type_of_mutation | Insertion | ttttcag | ||||||
Deletion | ||||||||
PCR_product | OK328_external | |||||||
OK328_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035524 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004033 | ||||||
Transcript | E01H11.1f.1 (11) | |||||||
E01H11.1c.1 (11) | ||||||||
E01H11.1e.1 (11) | ||||||||
E01H11.1d.1 (11) | ||||||||
E01H11.1b.1 (11) | ||||||||
E01H11.1a.1 (11) | ||||||||
Interactor | WBInteraction000519488 | |||||||
WBInteraction000519491 | ||||||||
WBInteraction000519494 | ||||||||
WBInteraction000519499 | ||||||||
Genetics | Mapping_data | In_multi_point | 4587 | |||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00041109 | ||||
Curator_confirmed | WBPerson8905 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00041109 | ||||
Curator_confirmed | WBPerson8905 | |||||||
WBPhenotype:0000146 | Paper_evidence | WBPaper00041109 | ||||||
Curator_confirmed | WBPerson8905 | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Localization of the synaptic protein SNG-1 is normal, based on expression analysis using an SNG-1::GFP transgene. | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001800 | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Normal increase in pnlp-29::GFP expression after infection. Injury response is also normal (data not shown) | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The PMA-induced upregulation of pnlp-29::GFP expression was normal in mutant worms | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00041109 | |||||||
WBPaper00028886 | ||||||||
WBPaper00033094 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |